Stem-loop sequence ame-mir-996

AccessionMI0010610 (change log)
DescriptionApis mellifera miR-996 stem loop
Gene family MIPF0000184; mir-279
Literature search

1 open access papers mention ame-mir-996
(1 sentences)

Stem-loop
   -        aauu  a            a  g    g    uuuug 
5'  aaacagau    cc uaggcgaguaug au uggu cacg     a
    ||||||||    || |||||||||||| || |||| ||||     u
3'  uuugucua    gg aucugcucauac ua auca gugc     u
   u        --au  c            a  g    -    uuuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
CM000058.5: 9791793-9791883 [-]
intergenic
Database links

Mature sequence ame-miR-996-3p

Accession MIMAT0010115
Sequence

56 - 

ugacuagauacauacucgucu

 - 76

Get sequence
Evidence experimental; Illumina [2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).