Stem-loop sequence ame-mir-252a

AccessionMI0010608 (change log)
Previous IDsame-mir-252
DescriptionApis mellifera miR-252 stem loop
Gene family MIPF0000285; mir-252
Literature search

2 open access papers mention ame-mir-252a
(2 sentences)

Stem-loop
   aau  u u  ug  c         a u  c       ugacuagguug   u g 
5'    cc g cu  uu auaaguacu g gc gcaggag           ggu a a
      || | ||  || ||||||||| | || |||||||           ||| |  
3'    gg c gg  aa uauucguga c cg cguccuc           cca u a
   ---  c u  gu  c         a u  u       -------uaua   u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
CM000066.5: 7005854-7005953 [-]
intergenic
Database links

Mature sequence ame-miR-252a-5p

Accession MIMAT0010113
Previous IDsame-miR-252
Sequence

16 - 

auaaguacuagugccgcaggag

 - 37

Get sequence
Evidence experimental; Illumina [2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).