Stem-loop sequence aga-mir-137

AccessionMI0010601 (change log)
DescriptionAnopheles gambiae miR-137 stem loop
Gene family MIPF0000106; mir-137
Stem-loop
   -aa   -     ug  c   c       ug   uac     c  ug 
5'    aac uuggu  gc acg guauucu  ggu   uaaca ac  u
      ||| |||||  || ||| |||||||  |||   ||||| ||  u
3'    uug gauca  ug ugc cauaaga  ucg   auugu ug  u
   aug   u     gu  a   a       gu   -uu     -  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chr2L: 11039426-11039516 [+]
intergenic
Database links

Mature sequence aga-miR-137

Accession MIMAT0010107
Sequence

55 - 

uauugcuugagaauacacguag

 - 76

Get sequence
Evidence by similarity; MI0005849

References

1
" Griffiths-Jones S Unpublished (2009).