Stem-loop sequence bfl-mir-125b

Accession

MI0010518 (change log)

Previous IDs

bfl-mir-125b-as

Description

Branchiostoma floridae miR-125b stem-loop

Gene family

MIPF0000033; mir-10

Stem-loop

   guggagggcguauguca    gc    -a          c     --g c 
5'                  ccca  uccc  agauccuaac uguga   c a
                    ||||  ||||  |||||||||| |||||   |  
3'                  gggu  aggg  ucugggauug acacu   g u
   ----------------g    -a    ac          a     aca g 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (JGI2; GCF_000003815.1): GG666478.1: 2707563-2707644 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bfl-mir-125b

• bfl-let-7a-2: GG666478.1: 2707847-2707945 [+]
• bfl-mir-125b: GG666478.1: 2707563-2707644 [-]
• bfl-mir-125a: GG666478.1: 2707548-2707648 [+]
• bfl-let-7b: GG666478.1: 2706003-2706084 [-]
• bfl-let-7a-1: GG666478.1: 2706001-2706082 [+]
• bfl-mir-100: GG666478.1: 2705733-2705832 [+]

Database links

• miRBase Tracker:MI0010518

Mature sequence bfl-miR-125b

• Accession: MIMAT0010007
• Previous IDs: bfl-miR-125b-as
• Sequence: 55 - ucacaaguuagggucucaggga - 76
• Evidence: experimental; cloned [1]

References

1. PMID:19196332 "Characterization of microRNAs in cephalochordates reveals a correlation between microRNA repertoire homology and morphological similarity in chordate evolution" Dai Z, Chen Z, Ye H, Zhou L, Cao L, Wang Y, Peng S, Chen L Evol Dev. 11:41-49(2009).