Stem-loop sequence bfl-mir-135a-1

AccessionMI0010501 (change log)
DescriptionBranchiostoma floridae miRa-135-1 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   -------------  g    a           cu          uau 
5'              gu uucu uggcuuucauc  augugaaugu   c
                || |||| |||||||||||  ||||||||||    
3'              ca aaga acugaaggugg  uacacuugua   g
   ucaaaggugugug  g    a           -u          cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666574.1: 3847395-3847476 [-]
intergenic
Clustered miRNAs
< 10kb from bfl-mir-135a-1
bfl-mir-135b-2GG666574.1: 3848991-3849062 [-]
bfl-mir-135a-2GG666574.1: 3848762-3848843 [-]
bfl-mir-135b-1GG666574.1: 3847619-3847690 [-]
bfl-mir-135a-1GG666574.1: 3847395-3847476 [-]
Database links

Mature sequence bfl-miR-135a

Accession MIMAT0009992
Sequence

7 - 

uauggcuuucauccuaugugaa

 - 28

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
2
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).