Stem-loop sequence bta-mir-1306

Accession

MI0010479 (change log)

Description

Bos taurus miR-1306 stem-loop

Gene family

MIPF0000531; mir-1306

Literature search

2 open access papers mention bta-mir-1306
(2 sentences)

Stem-loop

   c    u  ccu  a        guga   a 
5'  cacc cc   gc aacgucca    ugc g
    |||| ||   || ||||||||    |||  
3'  gugg gg   cg uugcaggu    aug a
   -    u  ucu  g        ---a   g 

Deep sequencing

1998 reads, 0 reads per million, 66 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr17: 75194445-75194502 [+]
• Overlapping transcripts:

  sense

  ENSBTAT00000026474 ; bta-mir-1306-201; 3'UTR (exon 1)

  ENSBTAT00000052889 ; bta-mir-1306-201; exon 1

Database links

• EntrezGene:MIR1306
• RNAcentral:URS000075B587_9913
• miRBase Tracker:MI0010479

Mature sequence bta-miR-1306

• Accession: MIMAT0009974
• Sequence: 1 - ccaccuccccugcaaacgucc - 21
• Deep sequencing: 1078 reads, 66 experiments
• Evidence: not experimental
• Predicted targets:
  • TargetScanVert:bta-miR-1306

References

1. PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).