Stem-loop sequence cfa-mir-454

AccessionMI0010426 (change log)
DescriptionCanis familiaris miR-454 stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   -          ---         ----   --u     g 
5'  agaacccuau   cgauauugu    cuc   gcugu u
    ||||||||||   |||||||||    |||   |||||  
3'  uuuugggaua   guuauaacg    gag   cgaua a
   g          uuc         ugau   ucu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr9: 33714192-33714261 [-]
sense
ENSCAFT00000042908 ; SKA2-201; intron 1
Database links

Mature sequence cfa-miR-454

Accession MIMAT0009927
Sequence

44 - 

uagugcaauauugcuuauaggg

 - 65

Get sequence
Evidence by similarity; MI0002076
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).