Stem-loop sequence sko-mir-2001

AccessionMI0010264 (change log)
DescriptionSaccoglossus kowalevskii miR-2001 stem-loop
Stem-loop
   a           c       a       --aucaa   c 
5'  cguuguuguga cguuaua ugggcau       gca c
    ||||||||||| ||||||| |||||||       |||  
3'  guaacaacauu gcgaugu auccgua       cgu a
   -           u       c       auacuaa   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL013840.1: 20661-20737 [-]
intergenic
Clustered miRNAs
< 10kb from sko-mir-2001
sko-mir-2001GL013840.1: 20661-20737 [-]
sko-mir-252bGL013840.1: 19591-19691 [-]
sko-mir-252aGL013840.1: 13957-14057 [-]
Database links

Mature sequence sko-miR-2001

Accession MIMAT0009735
Sequence

7 - 

uugugaccguuauaaugggcau

 - 28

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).