Stem-loop sequence lgi-mir-1986

AccessionMI0010257 (change log)
DescriptionLottia gigantea miR-1986 stem-loop
Gene family MIPF0000741; mir-1986
Stem-loop
   -cu    ug g        g      ca     cuua 
5'    auug  g cgcggauc uggggg  ccacu    c
      ||||  | |||||||| ||||||  |||||    u
3'    ugac  u gugccuag acccuu  ggugg    u
   acu    gu a        a      ua     cacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB202237.1: 81746-81821 [-]
intergenic
Clustered miRNAs
< 10kb from lgi-mir-1986
lgi-mir-1990KB202237.1: 82019-82087 [-]
lgi-mir-1986KB202237.1: 81746-81821 [-]
Database links

Mature sequence lgi-miR-1986

Accession MIMAT0009728
Sequence

46 - 

uggauuucccaagauccgugau

 - 67

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).