Stem-loop sequence spu-mir-252a

AccessionMI0010208 (change log)
DescriptionStrongylocentrotus purpuratus miR-252a stem-loop
Gene family MIPF0000285; mir-252
Stem-loop
   cacgugacuauguuccgucc             cg      aacugagaaggaaaguga 
5'                     uaaguacuagugc  uagguu                  a
                       |||||||||||||  ||||||                   
3'                     auucaugaucaug  guccag                  g
   -------------------a             au      acucuucgauaucagauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN912884.1: 120521-120621 [+]
intergenic
Clustered miRNAs
< 10kb from spu-mir-252a
spu-mir-2001KN912884.1: 112621-112691 [+]
spu-mir-252bKN912884.1: 119142-119242 [+]
spu-mir-252aKN912884.1: 120521-120621 [+]
Database links

Mature sequence spu-miR-252a

Accession MIMAT0009672
Sequence

20 - 

cuaaguacuagugccguagguu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).