Stem-loop sequence lgi-mir-981

AccessionMI0010141 (change log)
DescriptionLottia gigantea miR-981 stem-loop
Gene family MIPF0000710; mir-981
Stem-loop
   --uuuga         -    uu       --   u 
5'        cggguuucg cgau  gcgaaca  guc a
          ||||||||| ||||  |||||||  ||| a
3'        guccaaagc gcug  ugcuugu  uag c
   gaauucc         a    -u       gu   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB202367.1: 846609-846677 [+]
intergenic
Database links

Mature sequence lgi-miR-981

Accession MIMAT0009601
Sequence

43 - 

uucguugucgacgaaaccugccu

 - 65

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).