Stem-loop sequence lgi-mir-124

AccessionMI0010120 (change log)
DescriptionLottia gigantea miR-124 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   aauccaaaa     g       a            aaa        -  aa 
5'          uggcg aucuguu guguucacugug   gccuuggu gu  u
            ||||| ||||||| ||||||||||||   |||||||| ||  u
3'          acugc uggauaa cguaaguggcgc   cggaauua ca  a
   ucuucuaua     -       c            --a        u  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB200701.1: 2554505-2554605 [+]
intergenic
Database links

Mature sequence lgi-miR-124

Accession MIMAT0009578
Sequence

61 - 

uaaggcacgcggugaaugcca

 - 81

Get sequence
Evidence by similarity; MI0000444

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).