Stem-loop sequence lgi-mir-71

AccessionMI0010113 (change log)
DescriptionLottia gigantea miR-71 stem-loop
Gene family MIPF0000278; mir-71
Stem-loop
   --accaugcag         u  ug       a             auuca 
5'            cagaaaucu ug  aaagaca ggguagugagaug     a
              ||||||||| ||  ||||||| |||||||||||||      
3'            guuuuuaga ac  uuucugu cucaucauucuac     u
   aacuacuauag         u  gu       -             cauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB201304.1: 4515783-4515883 [-]
intergenic
Clustered miRNAs
< 10kb from lgi-mir-71
lgi-mir-2dKB201304.1: 4520058-4520158 [+]
lgi-mir-71KB201304.1: 4515783-4515883 [-]
Database links

Mature sequence lgi-miR-71

Accession MIMAT0009571
Sequence

22 - 

ugaaagacaaggguagugagaug

 - 44

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).