Stem-loop sequence lgi-mir-12

AccessionMI0010107 (change log)
DescriptionLottia gigantea miR-12 stem-loop
Stem-loop
   -----ugaccau   a    ug cgu      u   uc         ---  a 
5'             gac ucau  c   gaguau aca  agguacuga   gg a
               ||| ||||  |   |||||| |||  |||||||||   || u
3'             cug agua  g   cuuaua ugu  uccaugacu   uc g
   ccacgacccuuu   c    gu aau      c   cu         ggc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB201459.1: 809251-809351 [+]
intergenic
Clustered miRNAs
< 10kb from lgi-mir-12
lgi-mir-216bKB201459.1: 805719-805782 [+]
lgi-mir-216aKB201459.1: 807321-807413 [+]
lgi-mir-12KB201459.1: 809251-809351 [+]
Database links

Mature sequence lgi-miR-12

Accession MIMAT0009564
Sequence

21 - 

ugaguauuacaucagguacuga

 - 42

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).