Stem-loop sequence lgi-mir-10

AccessionMI0010106 (change log)
DescriptionLottia gigantea miR-10 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   gaaua   --u     --    u      u     uc          u  ga 
5'      uug   gccuu  uacg uuaccc guaga  cgaauuugug au  a
        |||   |||||  |||| |||||| |||||  |||||||||| ||   
3'      aac   uggag  gugu aguggg cguuu  gcuuaaacau ua  a
   acuaa   uuu     cu    u      -     uu          c  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB200129.1: 2577657-2577757 [-]
intergenic
Database links

Mature sequence lgi-miR-10

Accession MIMAT0009563
Sequence

21 - 

uacccuguagauccgaauuugu

 - 42

Get sequence
Evidence by similarity; MI0000266

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).