Stem-loop sequence lgi-mir-8

AccessionMI0010104 (change log)
DescriptionLottia gigantea miR-8 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   gagagaa       cug   -c      -    u    c      -uu   a 
5'        acgaauu   gug  caucuu acuu acag auuaga   ugu c
          |||||||   |||  |||||| |||| |||| ||||||   |||  
3'        ugcuuga   cac  guagaa ugga uguc uaaucu   aca g
   ----aag       -aa   cu      a    c    a      uuu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB202283.1: 826418-826515 [+]
intergenic
Database links

Mature sequence lgi-miR-8

Accession MIMAT0009561
Sequence

61 - 

uaauacugucagguaaagauguc

 - 83

Get sequence
Evidence by similarity; MI0000128

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).