Stem-loop sequence bfl-mir-92a-1

AccessionMI0010022 (change log)
DescriptionBranchiostoma floridae miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop 
   ca  u   --gu   cu      c     a    u    g       u   a 
5'   ca auu    gcc  gucaga agguc ggau ggug caaugcu aua a
     || |||    |||  |||||| ||||| |||| |||| ||||||| |||  
3'   gu uga    ugg  uagucu uccgg ccug ucac guuauga ugu c
   -c  c   aaau   -u      u     c    u    -       c   g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666632.1: 777177-777277 [-]
intergenic
Clustered miRNAs
< 10kb from bfl-mir-92a-1
bfl-mir-92a-1GG666632.1: 777177-777277 [-]
bfl-mir-92a-3GG666632.1: 776303-776384 [-]
bfl-mir-92a-2GG666632.1: 774437-774518 [-]
Database links

Mature sequence bfl-miR-92a

Accession MIMAT0009478
Sequence

60 -  

uauugcacuugucccggccuuu

 - 81

Get sequence
Evidence experimental; 454 [1], cloned [2]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2
PMID:19196332 "Characterization of microRNAs in cephalochordates reveals a correlation between microRNA repertoire homology and morphological similarity in chordate evolution" Dai Z, Chen Z, Ye H, Zhou L, Cao L, Wang Y, Peng S, Chen L Evol Dev. 11:41-49(2009).