![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-190 |
|||||
Accession | MI0009996 (change log) | ||||
Description | Bombyx mori miR-190 stem-loop | ||||
Gene family | MIPF0000076; mir-190 | ||||
Literature search |
1 open access papers mention bmo-mir-190 | ||||
Stem-loop |
ga c c -- a u u g 5' gccgcg gucgu gag auauguuugau uucu ggu guuu u |||||| ||||| ||| ||||||||||| |||| ||| |||| u 3' cggcgc cagca cuc uauacaaacua aggg cca uagg u -c - u au - c c u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bmo-miR-190-5p |
|
Accession | MIMAT0009153 |
Previous IDs | bmo-miR-190 |
Sequence |
17 - agauauguuugauauucuugguu - 39 |
Deep sequencing | 4313 reads, 3 experiments |
Evidence | experimental; RT-PCR [2], Illumina [3] |
Database links |
|
Mature sequence bmo-miR-190-3p |
|
Accession | MIMAT0015287 |
Previous IDs | bmo-miR-190* |
Sequence |
55 - cccgggaaucaaacauauuacucu - 78 |
Deep sequencing | 124 reads, 3 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
References |
|
1 |
PMID:18714353
"The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
PLoS One. 3:e2997(2008).
|
2 |
PMID:18977439
"Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
Insect Biochem Mol Biol. 38:1066-1071(2008).
|
3 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|