Stem-loop sequence bmo-mir-190

AccessionMI0009996 (change log)
DescriptionBombyx mori miR-190 stem-loop
Gene family MIPF0000076; mir-190
Literature search

1 open access papers mention bmo-mir-190
(3 sentences)

Stem-loop
   ga      c     c   --           a    u   u    g 
5'   gccgcg gucgu gag  auauguuugau uucu ggu guuu u
     |||||| ||||| |||  ||||||||||| |||| ||| |||| u
3'   cggcgc cagca cuc  uauacaaacua aggg cca uagg u
   -c      -     u   au           -    c   c    u 
Get sequence
Deep sequencing
4437 reads, 633 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581767.1: 450675-450764 [+]
intergenic
Database links

Mature sequence bmo-miR-190-5p

Accession MIMAT0009153
Previous IDsbmo-miR-190
Sequence

17 - 

agauauguuugauauucuugguu

 - 39

Get sequence
Deep sequencing4313 reads, 3 experiments
Evidence experimental; RT-PCR [2], Illumina [3]
Database links

Mature sequence bmo-miR-190-3p

Accession MIMAT0015287
Previous IDsbmo-miR-190*
Sequence

55 - 

cccgggaaucaaacauauuacucu

 - 78

Get sequence
Deep sequencing124 reads, 3 experiments
Evidence experimental; Illumina [3]
Database links

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).