![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-1948 |
|||||
Accession | MI0009939 (change log) | ||||
Symbol | MGI:Mir1948 | ||||
Description | Mus musculus miR-1948 stem-loop | ||||
Literature search |
1 open access papers mention mmu-mir-1948 | ||||
Stem-loop |
a a gug 5' auucucaccuuacu uaugagu uucugccuaaaugug u |||||||||||||| ||||||| ||||||||||||||| a 3' uaagaguggaauga augcuca gagacggauuuacau c c c agg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-1948-5p |
|
Accession | MIMAT0017344 |
Previous IDs | mmu-miR-1948* |
Sequence |
15 - auaugaguauucugccuaaau - 35 |
Deep sequencing | 228 reads, 37 experiments |
Evidence | experimental; 454 [2] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-1948-3p |
|
Accession | MIMAT0009415 |
Previous IDs | mmu-miR-1948 |
Sequence |
52 - uuuaggcagagcacucguacag - 73 |
Deep sequencing | 4389 reads, 65 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18849523
"In-depth characterization of the microRNA transcriptome in a leukemia progression model"
Genome Res. 18:1787-1797(2008).
|
2 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|