![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-1942 |
|||||
Accession | MI0009931 (change log) | ||||
Symbol | MGI:Mir1942 | ||||
Description | Mus musculus miR-1942 stem-loop | ||||
Literature search |
2 open access papers mention mmu-mir-1942 | ||||
Stem-loop |
--g u ua uu aa 5' aagaggcc auu aug agacaucu c |||||||| ||| ||| |||||||| 3' uucuccgg ugg uac ucuguaga c aug u uc -u cu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence mmu-miR-1942 |
|
Accession | MIMAT0009407 |
Sequence |
33 - ucagaugucuucaucugguug - 53 |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:18849523
"In-depth characterization of the microRNA transcriptome in a leukemia progression model"
Genome Res. 18:1787-1797(2008).
|