Stem-loop sequence bta-mir-92b

Accession

MI0009906 (change log)

Description

Bos taurus miR-92b stem-loop

Gene family

MIPF0000013; mir-25

Literature search

19 open access papers mention bta-mir-92b
(39 sentences)

Stem-loop

   c     cc   c    g     ga       c            uucuu 
5'  gggcc  ggg gggc ggagg  cgggacg ggugcaguguug     u
    |||||  ||| |||| |||||  ||||||| ||||||||||||     c
3'  cccgg  ucc cccg ccucc  gcccugc ucacguuauaac     c
   -     -c   -    g     -g       -            cgucc 

Deep sequencing

116317 reads, 747 reads per million, 74 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr3: 15638041-15638136 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR92B
• RNAcentral:URS000075AD5B_9913
• miRBase Tracker:MI0009906

Mature sequence bta-miR-92b

• Accession: MIMAT0009384
• Sequence: 61 - uauugcacucgucccggccucc - 82
• Deep sequencing: 115898 reads, 74 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • TargetScanVert:bta-miR-92b

References

1. PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2. PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).