![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-92a-1 |
||||||||||||||
Accession | MI0009905 (change log) | |||||||||||||
Previous IDs | bta-mir-92a | |||||||||||||
Description | Bos taurus miR-92a-1 stem-loop | |||||||||||||
Gene family | MIPF0000013; mir-25 | |||||||||||||
Literature search |
![]()
30 open access papers mention bta-mir-92a-1 | |||||||||||||
Stem-loop |
---cu uac c u uu 5' uuc acagguugggau ggu gcaaugcugug u ||| |||||||||||| ||| ||||||||||| 3' gag uguccggcccug uca cguuaugguau c gguuu --u u - gu |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence bta-miR-92a |
|
Accession | MIMAT0009383 |
Sequence |
48 - uauugcacuugucccggccugu - 69 |
Deep sequencing | 2284771 reads, 77 experiments |
Evidence | experimental; cloned [2] |
Predicted targets |
|
References |
|
1 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|
2 |
PMID:19758457
"Characterization of bovine miRNAs by sequencing and bioinformatics analysis"
BMC Mol Biol. 10:90(2009).
|