![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-502a-1 |
||||||||||||||
Accession | MI0009852 (change log) | |||||||||||||
Description | Bos taurus miR-502a-1 stem-loop | |||||||||||||
Gene family | MIPF0000139; mir-500 | |||||||||||||
Literature search |
2 open access papers mention bta-mir-502a-1 | |||||||||||||
Stem-loop |
u - - ucu uag - u 5' gcccaccc cucu aauccuugcuc gggugc ugc ug c |||||||| |||| ||||||||||| |||||| ||| || 3' cggguggg gaga uuaggaacggg uccacg acg ac u u a c --- -ua u c |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
Mature sequence bta-miR-502a |
|
Accession | MIMAT0009338 |
Sequence |
51 - aaugcaccugggcaaggauuca - 72 |
Deep sequencing | 22298 reads, 77 experiments |
Evidence | by similarity; MI0003186 |
Predicted targets |
|
References |
|
1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
2 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|