Stem-loop sequence bta-mir-451

AccessionMI0009837 (change log)
DescriptionBos taurus miR-451 stem-loop
Gene family MIPF0000148; mir-451
Literature search

18 open access papers mention bta-mir-451
(56 sentences)

Stem-loop 
   c     - ug     ga                 a 
5'  uuggg g  gcgag  aaccguuaccauuacug g
    ||||| |  |||||  |||||||||||||||||  
3'  gaccc c  cguuc  uuggcaaugguaaugau u
   a     a gu     uc                 u
Get sequence
Deep sequencing
8812 reads, 21.5 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 20922863-20922933 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-451
bta-mir-144chr19: 20923025-20923108 [-]
bta-mir-451chr19: 20922863-20922933 [-]
Database links

Mature sequence bta-miR-451

Accession MIMAT0009323
Sequence

16 -  

aaaccguuaccauuacugaguuu

 - 38

Get sequence
Deep sequencing8808 reads, 65 experiments
Evidence experimental; cloned [3-4]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).