Stem-loop sequence bta-mir-375

AccessionMI0009817 (change log)
DescriptionBos taurus miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

16 open access papers mention bta-mir-375
(22 sentences)

Stem-loop 
   c  -    a      ccu  c     c  gac 
5'  cc cgcg cgagcc   cg acaaa cg   c
    || |||| ||||||   || ||||| ||    
3'  gg gugc gcucgg   gc uguuu gc   u
   c  a    -      cuu  u     u  gag
Get sequence
Deep sequencing
210149 reads, 2.18e+03 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 108046949-108047012 [-]
sense
ENSBTAT00000042142 ; bta-mir-375-201; exon 1
Database links

Mature sequence bta-miR-375

Accession MIMAT0009303
Sequence

39 -  

uuuuguucguucggcucgcguga

 - 61

Get sequence
Deep sequencing210134 reads, 76 experiments
Evidence experimental; Array [3], qRT-PCR [3], cloned [4]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).