Stem-loop sequence bta-mir-338

AccessionMI0009805 (change log)
DescriptionBos taurus miR-338 stem-loop
Gene family MIPF0000097; mir-338
Literature search

5 open access papers mention bta-mir-338
(16 sentences)

Stem-loop 
   gcacg   c      cc      u   -         -   ga  a 
5'      ggc guccuc  caacaa auc cuggugcug agu  ug c
        ||| ||||||  |||||| ||| ||||||||| |||  || a
3'      ucg cgggag  guuguu uag gacuacgac uca  gc c
   -accg   a      aa      u   u         c   ac  a
Get sequence
Deep sequencing
8265 reads, 32.9 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 52407324-52407415 [+]
sense
ENSBTAT00000025356 ; AATK-201; intron 6
Clustered miRNAs
< 10kb from bta-mir-338
bta-mir-338chr19: 52407324-52407415 [+]
bta-mir-3065chr19: 52407338-52407400 [-]
Database links

Mature sequence bta-miR-338

Accession MIMAT0009292
Sequence

55 -  

uccagcaucagugauuuuguuga

 - 77

Get sequence
Deep sequencing7233 reads, 70 experiments
Evidence experimental; cloned [3-4]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).