![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-338 |
||||||
Accession | MI0009805 (change log) | |||||
Description | Bos taurus miR-338 stem-loop | |||||
Gene family | MIPF0000097; mir-338 | |||||
Literature search |
![]()
5 open access papers mention bta-mir-338 | |||||
Stem-loop |
gcacg c cc u - - ga a 5' ggc guccuc caacaa auc cuggugcug agu ug c ||| |||||| |||||| ||| ||||||||| ||| || a 3' ucg cgggag guuguu uag gacuacgac uca gc c -accg a aa u u c ac a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bta-miR-338 |
|
Accession | MIMAT0009292 |
Sequence |
55 - uccagcaucagugauuuuguuga - 77 |
Deep sequencing | 7233 reads, 70 experiments |
Evidence | experimental; cloned [3-4] |
Predicted targets |
|
References |
|
1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
2 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|
3 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|
4 |
PMID:19758457
"Characterization of bovine miRNAs by sequencing and bioinformatics analysis"
BMC Mol Biol. 10:90(2009).
|