Stem-loop sequence bta-mir-32

AccessionMI0009796 (change log)
DescriptionBos taurus miR-32 stem-loop
Gene family MIPF0000069; mir-32
Literature search

7 open access papers mention bta-mir-32
(11 sentences)

Stem-loop 
           ug      a          -  uu  c 
5' ggagguau  cacaug cuaaguugca ug  gu a
   ||||||||  |||||| |||||||||| ||  ||  
3' cuuuuaua  guguau gauuuaacgu ac  cg c
           gu      -          g  uc  g
Get sequence
Deep sequencing
10455 reads, 124 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 100883622-100883691 [-]
sense
ENSBTAT00000053653 ; TMEM245-201; intron 14
Database links

Mature sequence bta-miR-32

Accession MIMAT0009283
Sequence

6 -  

uauugcacaugacuaaguugcau

 - 28

Get sequence
Deep sequencing9983 reads, 74 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).