![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-199a-2 |
||||||
Accession | MI0009770 (change log) | |||||
Description | Bos taurus miR-199a-2 stem-loop | |||||
Gene family | MIPF0000040; mir-199 | |||||
Literature search |
![]()
24 open access papers mention bta-mir-199a-2 | |||||
Stem-loop |
aac u c ------ g 5' gcc ccagugu cagacuac ugu ucagg g ||| ||||||| |||||||| ||| ||||| 3' cgg gguuaca gucugaug aca agucu g auu c - ugugua c |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bta-miR-199a-5p |
|
Accession | MIMAT0003544 |
Previous IDs | bta-miR-199a |
Sequence |
6 - cccaguguucagacuaccuguu - 27 |
Deep sequencing | 99439 reads, 64 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
Mature sequence bta-miR-199a-3p |
|
Accession | MIMAT0003746 |
Previous IDs | bta-miR-199a* |
Sequence |
47 - acaguagucugcacauugguua - 68 |
Deep sequencing | 733416 reads, 68 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
3 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|