Stem-loop sequence bta-mir-199a-2

Accession

MI0009770 (change log)

Description

Bos taurus miR-199a-2 stem-loop

Gene family

MIPF0000040; mir-199

Literature search

24 open access papers mention bta-mir-199a-2
(77 sentences)

Stem-loop

      aac       u        c   ------     g 
5' gcc   ccagugu cagacuac ugu      ucagg g
   |||   ||||||| |||||||| |||      |||||  
3' cgg   gguuaca gucugaug aca      agucu g
      auu       c        -   ugugua     c 

Deep sequencing

416214 reads, 3.31e+03 reads per million, 68 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr7: 16580964-16581034 [-]
• Overlapping transcripts:

  sense

  ENSBTAT00000042269 ; bta-mir-3604-1-201; exon 1

  antisense

  ENSBTAT00000036123 ; DNM2-201; intron 13

Clustered miRNAs

< 10kb from bta-mir-199a-2

• bta-mir-199a-2: chr7: 16580964-16581034 [-]
• bta-mir-3604-1: chr7: 16580960-16581037 [+]

Database links

• EntrezGene:MIR199A-2
• RNAcentral:URS000075D956_9913
• miRBase Tracker:MI0009770

Mature sequence bta-miR-199a-5p

• Accession: MIMAT0003544
• Previous IDs: bta-miR-199a
• Sequence: 6 - cccaguguucagacuaccuguu - 27
• Deep sequencing: 99439 reads, 64 experiments
• Evidence: experimental; cloned [1-2]
• Predicted targets:
  • TargetScanVert:bta-miR-199a-5p

Mature sequence bta-miR-199a-3p

• Accession: MIMAT0003746
• Previous IDs: bta-miR-199a*
• Sequence: 47 - acaguagucugcacauugguua - 68
• Deep sequencing: 733416 reads, 68 experiments
• Evidence: experimental; cloned [1-2]
• Predicted targets:
  • TargetScanVert:bta-miR-199a-3p

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3. PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).