![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-190a |
|||||
Accession | MI0009762 (change log) | ||||
Description | Bos taurus miR-190a stem-loop | ||||
Gene family | MIPF0000076; mir-190 | ||||
Literature search |
![]()
5 open access papers mention bta-mir-190a | ||||
Stem-loop |
u c u - ug ua uuau 5' gcagg c cugu g auauguuugauauau gguug u ||||| | |||| | ||||||||||||||| ||||| 3' cguuc g gaca c uauacaaacuauaua ucaac u c u u u cu -- cuaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence bta-miR-190a |
|
Accession | MIMAT0009251 |
Sequence |
15 - ugauauguuugauauauuaggu - 36 |
Deep sequencing | 775 reads, 67 experiments |
Evidence | experimental; Array [3], qRT-PCR [3] |
Predicted targets |
|
References |
|
1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
2 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|
3 |
PMID:19170227
"Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"
Mol Reprod Dev. 76:665-677(2009).
|