Stem-loop sequence bta-mir-138-1

AccessionMI0009741 (change log)
DescriptionBos taurus miR-138-1 stem-loop
Gene family MIPF0000075; mir-138
Literature search

9 open access papers mention bta-mir-138-1
(15 sentences)

Stem-loop 
   -    cac    c    g   ag             uca      - gcca 
5'  cugg   ggug ggug ggc  cugguguugugaa   ggccgu c    a
    ||||   |||| |||| |||  |||||||||||||   |||||| |     
3'  gacc   ccac ccac cug  gaccacaacacuu   ucggca g    u
   g    ---    c    a   -g             -ca      a agac
Get sequence
Deep sequencing
4301 reads, 20.9 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 14939860-14939956 [+]
intergenic
Database links

Mature sequence bta-miR-138

Accession MIMAT0003813
Sequence

21 -  

agcugguguugugaaucaggccg

 - 43

Get sequence
Deep sequencing8582 reads, 67 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).