Stem-loop sequence bta-mir-133b

Accession

MI0009734 (change log)

Description

Bos taurus miR-133b stem-loop

Gene family

MIPF0000029; mir-133

Literature search

14 open access papers mention bta-mir-133b
(50 sentences)

Stem-loop

   -------       c        ca  c  a      u  g      
5'        cccugcu uggcuggu  aa gg accaag cc ucuuc 
          ||||||| ||||||||  || || |||||| || |||| c
3'        gggacga aucgacca  uu cc ugguuu gg agagu 
   aacgguc       c        ac  c  c      -  -      

Deep sequencing

31181 reads, 259 reads per million, 66 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr23: 24357763-24357846 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bta-mir-133b

• bta-mir-206: chr23: 24353667-24353752 [+]
• bta-mir-133b: chr23: 24357763-24357846 [+]

Database links

• EntrezGene:MIR133B
• miRBase Tracker:MI0009734

Mature sequence bta-miR-133b

• Accession: MIMAT0009226
• Sequence: 48 - uuugguccccuucaaccagcua - 69
• Deep sequencing: 31181 reads, 66 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • TargetScanVert:bta-miR-133b

References

1. PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2. PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3. PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).