![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-129-1 |
|||||
Accession | MI0009728 (change log) | ||||
Description | Bos taurus miR-129-1 stem-loop | ||||
Gene family | MIPF0000073; mir-129 | ||||
Literature search |
![]()
5 open access papers mention bta-mir-129-1 | ||||
Stem-loop |
- c cu g uu cu c 5' ggau cuuuuug ggu gggcuu cug c cu u |||| ||||||| ||| |||||| ||| | || 3' ucua gaaaaac cca cccgaa gac g ga a u c uu g -u au c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-129 |
|
Accession | MIMAT0009220 |
Sequence |
5 - cuuuuugcggucugggcuugcu - 26 |
Deep sequencing | 1259 reads, 61 experiments |
Evidence | experimental; cloned [3] |
Predicted targets |
|
References |
|
1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
2 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|
3 |
PMID:19758457
"Characterization of bovine miRNAs by sequencing and bioinformatics analysis"
BMC Mol Biol. 10:90(2009).
|