Stem-loop sequence bta-mir-100

Accession

MI0009720 (change log)

Description

Bos taurus miR-100 stem-loop

Gene family

MIPF0000033; mir-10

Literature search

15 open access papers mention bta-mir-100
(45 sentences)

Stem-loop

   ccuguugc    a   cg    uc   a      -  gg 
5'         caca acc  uaga  cga cuugug gu  u
           |||| |||  ||||  ||| |||||| ||   
3'         gugu ugg  aucu  guu gaacac cg  a
   ---ugucu    a   au    gu   c      a  ug 

Deep sequencing

123963 reads, 2.05e+03 reads per million, 78 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr15: 33539274-33539349 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bta-mir-100

• bta-mir-100: chr15: 33539274-33539349 [-]
• bta-let-7a-2: chr15: 33533448-33533519 [-]

Database links

• EntrezGene:MIR100
• RNAcentral:URS000075C831_9913
• miRBase Tracker:MI0009720

Mature sequence bta-miR-100

• Accession: MIMAT0009215
• Sequence: 13 - aacccguagauccgaacuugug - 34
• Deep sequencing: 123777 reads, 78 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • TargetScanVert:bta-miR-100

References

1. PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2. PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3. PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).