![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dwi-mir-318-1 |
|||||
Accession | MI0009602 (change log) | ||||
Description | Drosophila willistoni miR-318-1 stem-loop | ||||
Gene family | MIPF0000259; mir-318 | ||||
Stem-loop |
- c c uu - ca 5' uuuaugggaua ac aaguucagu ug ucg u ||||||||||| || ||||||||| || ||| u 3' agauacucuau ug uucggguca ac agc c g u u cu g ac |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence dwi-miR-318 |
|
Accession | MIMAT0009015 |
Sequence |
45 - ucacugggcuuuguuuaucuca - 66 |
Evidence | by similarity; MI0000430 |
References |
|
1 |
PMID:17994087
"Evolution of genes and genomes on the Drosophila phylogeny"
Nature. 450:203-218(2007).
|