Stem-loop sequence dvi-mir-100

AccessionMI0009541 (change log)
DescriptionDrosophila virilis miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -c    a     aa       au   aa      - u uuu 
5'   cauu acaga  cccguaa  ccg  cuugug c g   u
     |||| |||||  |||||||  |||  |||||| | |    
3'   guaa ugucu  ggguauu  ggc  gaacau g c   a
   ac    c     ga       ac   ca      u u uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12963: 18449845-18449926 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-100
dvi-mir-100scaffold_12963: 18449845-18449926 [+]
dvi-let-7scaffold_12963: 18451352-18451429 [+]
dvi-mir-125scaffold_12963: 18451658-18451767 [+]
Database links

Mature sequence dvi-miR-100-5p

Accession MIMAT0008973
Previous IDsdvi-miR-100
Sequence

12 - 

aacccguaaauccgaacuug

 - 31

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-100-3p

Accession MIMAT0032093
Sequence

51 - 

caagaccggcauuaugggaguc

 - 72

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).