Stem-loop sequence dan-mir-306

AccessionMI0008984 (change log)
DescriptionDrosophila ananassae miR-306 stem-loop
Gene family MIPF0000313; mir-306
Stem-loop
      -    u   a          uu    a       ugcau 
5' guc cacu ggu gcucagguac  agug cucucaa     u
   ||| |||| ||| ||||||||||  |||| |||||||     u
3' cag guga cua cggguccgug  ucac gaggguu     g
      c    -   c          uu    c       uuaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_12916: 15864863-15864947 [-]
intergenic
Clustered miRNAs
< 10kb from dan-mir-306
dan-mir-9cscaffold_12916: 15865474-15865565 [-]
dan-mir-306scaffold_12916: 15864863-15864947 [-]
dan-mir-79scaffold_12916: 15864720-15864810 [-]
dan-mir-9bscaffold_12916: 15864541-15864628 [-]
Database links

Mature sequence dan-miR-306

Accession MIMAT0008450
Sequence

15 - 

ucagguacuuagugacucucaa

 - 36

Get sequence
Evidence by similarity; MI0000414

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).