Stem-loop sequence ptr-mir-942

AccessionMI0008888 (change log)
DescriptionPan troglodytes miR-942 stem-loop
Gene family MIPF0000511; mir-942
Stem-loop
   a           u                       uacuca 
5'  uuaggagagua cuucucuguuuuggccaugugug      c
    ||||||||||| |||||||||||||||||||||||       
3'  aauccuuucau gaagagacaaagccgguacacac      a
   -           u                       uccccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 118704266-118704350 [-]
sense
ENSPTRT00000063518 ; ptr-mir-942-201; exon 1
ENSPTRT00000002162 ; TTF2-201; intron 18
Database links

Mature sequence ptr-miR-942

Accession MIMAT0008348
Sequence

13 - 

ucuucucuguuuuggccaugug

 - 34

Get sequence
Evidence by similarity; MI0005767
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).