Stem-loop sequence ptr-mir-449b

AccessionMI0008671 (change log)
DescriptionPan troglodytes miR-449b stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   ----------ga  u   u     a     u   uu   a c        u  gu 
5'             cc gaa caggu ggcag gua  guu g uggcugcu gg  c
               || ||| ||||| ||||| |||  ||| | |||||||| ||   
3'             gg cuu guuca ccguc cau  caa c accgacga cu  a
   ucuucuuaaaua  u   c     -     c   --   - -        -  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr5: 59474515-59474610 [+]
sense
ENSPTRT00000054707 ; ptr-mir-449b-201; exon 1
ENSPTRT00000031293 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from ptr-mir-449b
ptr-mir-449cchr5: 59472899-59473009 [+]
ptr-mir-449bchr5: 59474515-59474610 [+]
ptr-mir-449achr5: 59474635-59474724 [+]
Database links

Mature sequence ptr-miR-449b

Accession MIMAT0008150
Sequence

15 - 

aggcaguguauuguuagcuggc

 - 36

Get sequence
Evidence by similarity; MI0003673
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).