Stem-loop sequence ptr-mir-320c-2

AccessionMI0008611 (change log)
DescriptionPan troglodytes miR-320c-2 stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   ---     uu       c     ag 
5'    uucuc  uccaguu uuccc  a
      |||||  ||||||| |||||   
3'    gagag  gggucga aaggg  a
   ugg     uu       a     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr18: 21398669-21398717 [+]
sense
ENSPTRT00000061467 ; ptr-mir-320c-2-201; exon 1
antisense
ENSPTRT00000018230 ; OSBPL1A-201; intron 7
Database links

Mature sequence ptr-miR-320c

Accession MIMAT0008095
Sequence

30 - 

aaaagcuggguugagagggu

 - 49

Get sequence
Evidence by similarity; MI0008191
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).