Stem-loop sequence ptr-mir-320c-1

AccessionMI0008610 (change log)
DescriptionPan troglodytes miR-320c-1 stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   -        --aaaaugag        uu       c    cag 
5'  uugcauua          gccuucuc  cccaguu uucc   a
    ||||||||          ||||||||  ||||||| ||||    
3'  gauguagu          ugggagag  gggucga aagg   g
   g        aaaaaaaaga        uu       a    acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr18: 18694050-18694136 [+]
sense
ENSPTRT00000068360 ; ptr-mir-320c-1-201; exon 1
antisense
ENSPTRT00000018198 ; ABHD3-201; intron 4
Database links

Mature sequence ptr-miR-320c

Accession MIMAT0008095
Sequence

49 - 

aaaagcuggguugagagggu

 - 68

Get sequence
Evidence by similarity; MI0008191
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).