Stem-loop sequence ptr-mir-320b-2

AccessionMI0008609 (change log)
DescriptionPan troglodytes miR-320b-2 stem-loop
Gene family MIPF0000163; mir-320
Literature search

1 open access papers mention ptr-mir-320b-2
(8 sentences)

Stem-loop
   - g      ---uu    uucuaccua        ------g  u   ag        uu     -a       a 
5'  u uuauuu     uguc         agaauucu       uc cuu  gcuuucuc  cccag  uuuccca a
    | ||||||     ||||         ||||||||       || |||  ||||||||  |||||  |||||||  
3'  g gauaga     acag         ucuuaaga       ag gaa  cgggagag  ggguc  aaagggu g
   a g      uuaau    ---ucucug        aaaaaaa  -   aa        uu     ga       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 203209046-203209182 [-]
sense
ENSPTRT00000068825 ; ptr-mir-320b-2-201; exon 1
Database links

Mature sequence ptr-miR-320b

Accession MIMAT0008094
Sequence

72 - 

aaaagcuggguugagagggcaa

 - 93

Get sequence
Evidence by similarity; MI0003839
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).