Stem-loop sequence ptr-mir-320b-1

AccessionMI0008608 (change log)
DescriptionPan troglodytes miR-320b-1 stem-loop
Gene family MIPF0000163; mir-320
Literature search

1 open access papers mention ptr-mir-320b-1
(8 sentences)

Stem-loop
   --------------aauuaau       uu       c     ag 
5'                      cccucuc  ucuaguu uuccu  a
                        |||||||  ||||||| |||||   
3'                      gggagag  gggucga aagga  g
   uaauuaaucaauuaaacaaac       uu       a     gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 119168471-119168548 [-]
sense
ENSPTRT00000060697 ; ptr-mir-320b-1-201; exon 1
Database links

Mature sequence ptr-miR-320b

Accession MIMAT0008094
Sequence

39 - 

aaaagcuggguugagagggcaa

 - 60

Get sequence
Evidence by similarity; MI0003839
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).