Stem-loop sequence ptr-mir-320a

AccessionMI0008607 (change log)
DescriptionPan troglodytes miR-320a stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   g     c    -cuc         uu       c      g 
5'  cuucg uccu    cgccuucuc  cccgguu uucccg a
    ||||| ||||    |||||||||  ||||||| ||||||  
3'  ggagu agga    gcgggagag  gggucga aagggc g
   -     -    aaaa         uu       a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr8: 21550280-21550360 [-]
intergenic
Database links

Mature sequence ptr-miR-320a

Accession MIMAT0008093
Sequence

48 - 

aaaagcuggguugagagggcga

 - 69

Get sequence
Evidence by similarity; MI0000542
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).