![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptr-mir-30c-1 |
||||||
Accession | MI0008605 (change log) | |||||
Description | Pan troglodytes miR-30c-1 stem-loop | |||||
Gene family | MIPF0000005; mir-30 | |||||
Literature search |
2 open access papers mention ptr-mir-30c-1 | |||||
Stem-loop |
- cu ugu u u aca ---g a 5' ccaug guag g guaaaca ccu cucucagcu ug g ||||| |||| | ||||||| ||| ||||||||| || 3' gguac cguc c cauuugu ggg gagggucgg ac c a -- uuc u u --a ugga u |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence ptr-miR-30c |
|
Accession | MIMAT0002614 |
Sequence |
16 - uguaaacauccuacacucucagc - 38 |
Evidence | by similarity; MI0000736 |
Predicted targets |
|
References |
|
1 |
PMID:18760970
"Computational identification of novel microRNA homologs in the chimpanzee genome"
Comput Biol Chem. 33:62-70(2009).
|