Stem-loop sequence sly-MIR397

Accession

MI0008371 (change log)

Description

Solanum lycopersicum miR397 stem-loop

Gene family

MIPF0000120; MIR397

Literature search

7 open access papers mention sly-MIR397
(26 sentences)

Stem-loop

        uac                  gc           cau uu    -   u   gc 
5' cagag   uuagaaacaugauugagu  agcguugauga   a  ugag aag ccu  a
   |||||   ||||||||||||||||||  |||||||||||   |  |||| ||| |||   
3' gucuc   aauuuuuguacuagcuca  ucgcaacuacu   u  acuc uuc ggg  u
        -uu                  aa           --u uu    c   c   uu 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (SL2.50; GCA_000188115.2): chr7: 66059126-66059241 [-]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS000075B8C6_4081
• miRBase Tracker:MI0008371

Mature sequence sly-miR397-5p

• Accession: MIMAT0007928
• Sequence: 20 - auugagugcagcguugauga - 39
• Evidence: experimental; 454 [1]

Mature sequence sly-miR397-3p

• Accession: MIMAT0037335
• Sequence: 82 - ucaacgcuaaacucgaucaug - 102
• Evidence: experimental; Illumina [2]

References

1. PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).
2. PMID:25218481 "Prediction and characterization of Tomato leaf curl New Delhi virus (ToLCNDV) responsive novel microRNAs in Solanum lycopersicum" Pradhan B, Naqvi AR, Saraf S, Mukherjee SK, Dey N Virus Res. 195:183-195(2015).