Stem-loop sequence bmo-mir-79

Accession

MI0008343 (change log)

Description

Bombyx mori miR-79 stem-loop

Gene family

MIPF0000014; mir-9

Literature search

7 open access papers mention bmo-mir-79
(11 sentences)

Stem-loop

   -cgccgccg      c     c       cg        cc    - auc 
5'          ggcgcg ugcga gcuuugg  auuuagcu  guga c   a
            |||||| ||||| |||||||  ||||||||  |||| |    
3'          ccgcgc gcgcu cgaaacc  uagaucga  uacu g   u
   gcaacucug      u     a       au        aa    u ccu 

Deep sequencing

4404 reads, 667 reads per million, 3 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (ASM15162v1; GCA_000151625.1): NW_004581774.1: 31444-31543 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bmo-mir-79

• bmo-mir-9c: NW_004581774.1: 28981-29088 [+]
• bmo-mir-306a: NW_004581774.1: 30978-31085 [+]
• bmo-mir-306b: NW_004581774.1: 30994-31069 [-]
• bmo-mir-79: NW_004581774.1: 31444-31543 [+]
• bmo-mir-9b: NW_004581774.1: 31448-31537 [-]

Database links

• miRBase Tracker:MI0008343

Mature sequence bmo-miR-79-5p

• Accession: MIMAT0015275
• Previous IDs: bmo-miR-79*
• Sequence: 23 - cuuuggcgauuuagcuccguga - 44
• Deep sequencing: 7 reads, 2 experiments
• Evidence: experimental; Illumina [3]

Mature sequence bmo-miR-79-3p

• Accession: MIMAT0007899
• Previous IDs: bmo-miR-79
• Sequence: 55 - uucauaaagcuagauuaccaaagcau - 80
• Deep sequencing: 4394 reads, 3 experiments
• Evidence: experimental; RT-PCR [2], Illumina [3]
• Database links:
  • RNAcentral:URS00003FF926_7091

References

1. PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2. PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
3. PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).