![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-13b |
||||||||||||
Accession | MI0008342 (change log) | |||||||||||
Description | Bombyx mori miR-13b stem-loop | |||||||||||
Gene family | MIPF0000049; mir-2 | |||||||||||
Literature search |
![]()
5 open access papers mention bmo-mir-13b | |||||||||||
Stem-loop |
guc - - uc u c 5' cauggccca cucgu aaaaauggcugug gug ag a ||||||||| ||||| ||||||||||||| ||| || a 3' gugucgggu gagca uuuuuaccgacac uac uc c --u u g ua - c |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: high
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
|
Mature sequence bmo-miR-13b-5p |
|
Accession | MIMAT0015274 |
Previous IDs | bmo-miR-13b* |
Sequence |
14 - ucguaaaaauggcugugucgug - 35 |
Deep sequencing | 45 reads, 3 experiments |
Evidence | experimental; Illumina [3] |
Mature sequence bmo-miR-13b-3p |
|
Accession | MIMAT0007898 |
Previous IDs | bmo-miR-13b |
Sequence |
48 - uaucacagccauuuuugacgagu - 70 |
Deep sequencing | 479 reads, 3 experiments |
Evidence | experimental; Northern [1], cloned [2], Illumina [3] |
Database links |
|
References |
|
1 |
PMID:18507836
"Identification and characteristics of microRNAs from Bombyx mori"
BMC Genomics. 9:248(2008).
|
2 |
PMID:18714353
"The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
PLoS One. 3:e2997(2008).
|
3 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|