Stem-loop sequence hsa-mir-1908

Accession

MI0008329 (change log)

Symbol

HGNC:MIR1908

Description

Homo sapiens miR-1908 stem-loop

Gene family

MIPF0001021; mir-1908

Literature search

19 open access papers mention hsa-mir-1908
(146 sentences)

Stem-loop

   ----    aau    c       a     au    cc    g 
5'     cggg   gccg ggcgggg cggcg  uggu  guau u
       ||||   |||| ||||||| |||||  ||||  |||| g
3'     gccc   cggc ccgccuc gccgc  gcca  cgug u
   cccc    --c    c       g     cg    -c    g 

Deep sequencing

1103 reads, 20.5 reads per million, 117 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr11: 61815161-61815240 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR1908
• HGNC:MIR1908
• RNAcentral:URS000075C0B7_9606
• miRBase Tracker:MI0008329

Mature sequence hsa-miR-1908-5p

• Accession: MIMAT0007881
• Sequence: 12 - cggcggggacggcgauugguc - 32
• Deep sequencing: 876 reads, 109 experiments
• Evidence: experimental; 454 [1-2], Illumina [3]
• Database links:
  • RNAcentral:URS00002373FD_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-1908-5p
  • miRDB:hsa-miR-1908-5p
  • microrna.org:hsa-miR-1908-5p

Mature sequence hsa-miR-1908-3p

• Accession: MIMAT0026916
• Sequence: 49 - ccggccgccggcuccgccccg - 69
• Deep sequencing: 194 reads, 72 experiments
• Evidence: experimental; Illumina [4]
• Predicted targets:
  • TargetScanVert:hsa-miR-1908-3p
  • miRDB:hsa-miR-1908-3p

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2. PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).
3. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
4. PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).