Stem-loop sequence ssc-mir-210

AccessionMI0008220 (change log)
DescriptionSus scrofa miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

11 open access papers mention ssc-mir-210
(27 sentences)

Stem-loop 
   gc    gg     a   cc   -      c  c -     
5'   gcag  cagcc cug  cac cgcaca ug g cugc 
     ||||  ||||| |||  ||| |||||| || | ||| u
3'   uguc  gucgg gac  gug gcgugu ac c ggcc 
   cc    ua     c   -a   u      c  c a
Get sequence
Deep sequencing
127 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 339074-339149 [+]
sense
ENSSSCT00000020678 ; ssc-mir-210.1-201; exon 1
Database links

Mature sequence ssc-miR-210

Accession MIMAT0007761
Sequence

48 -  

cugugcgugugacagcggcuga

 - 69

Get sequence
Deep sequencing97 reads, 13 experiments
Evidence experimental; cloned [1], Illumina [2-4]

References

1
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).