Stem-loop sequence ssc-mir-185

AccessionMI0008218 (change log)
DescriptionSus scrofa miR-185 stem-loop
Gene family MIPF0000202; mir-185
Literature search

5 open access papers mention ssc-mir-185
(10 sentences)

Stem-loop 
   ---  u       ug   a     g         au  uc 
5'    gg gagggau  gag gaaag caguuccug  gg  c
      || |||||||  ||| ||||| |||||||||  ||   
3'    cc cuuccug  cuc cuuuc gucggggac  cc  c
   ccu  -       gu   -     g         -c  uc
Get sequence
Deep sequencing
3072 reads, 1.05e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr14: 55086524-55086599 [+]
intergenic
Database links

Mature sequence ssc-miR-185

Accession MIMAT0007759
Sequence

11 -  

uggagagaaaggcaguuccuga

 - 32

Get sequence
Deep sequencing3057 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2-4]

References

1
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).