![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ssc-mir-185 |
|||||
Accession | MI0008218 (change log) | ||||
Description | Sus scrofa miR-185 stem-loop | ||||
Gene family | MIPF0000202; mir-185 | ||||
Literature search |
![]()
5 open access papers mention ssc-mir-185 | ||||
Stem-loop |
--- u ug a g au uc 5' gg gagggau gag gaaag caguuccug gg c || ||||||| ||| ||||| ||||||||| || 3' cc cuuccug cuc cuuuc gucggggac cc c ccu - gu - g -c uc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence ssc-miR-185 |
|
Accession | MIMAT0007759 |
Sequence |
11 - uggagagaaaggcaguuccuga - 32 |
Deep sequencing | 3057 reads, 15 experiments |
Evidence | experimental; cloned [1], Illumina [2-4] |
References |
|
1 |
PMID:18548309
"Identification and characterization of new microRNAs from pig"
Mamm Genome. 19:570-580(2008).
|
2 |
PMID:19917043
"MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
Anim Genet. 41:159-168(2010).
|
3 |
PMID:21312241
"MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing"
J Cell Biochem. 112:1318-1328(2011).
|
4 |
PMID:24499489
"Exploration of microRNAs in porcine milk exosomes"
BMC Genomics. 15:100(2014).
|